Journal: Oncogene

Article Title: Using a novel computational drug-repositioning approach (DrugPredict) to rapidly identify potent drug candidates for cancer treatment

doi: 10.1038/onc.2017.328

Figure Lengend Snippet: Indomethacin downregulates Wnt/β-catenin signaling in platinum-resistant ovarian tumor cells. ( a ) Western blot showing robust decrease in β-catenin protein level by 24 h upon treatment with Indomethacin in OV81.2-CP10 and CP70 cells and enhanced β-catenin downregulation in cisplatin plus Indomethacin combination treated OV81.2-CP10 and CP70 cells as compared with individual drug treatment alone 24 h. ( b ) Real-time PCR analysis 24 h showing Indomethacin decreases mRNA expression of β-catenin transcriptional targets AXIN2, TCF7, LEF-1 and LGR5 in OV81.2-CP10 and CP70. ( c ) Western blot showing overexpression of non-degradable β-catenin (β-S33Y) in OV81.2 (left) and effect of Indomethacin on β-catenin protein expression in OV81.2-β- S33Y cells (right). ( d ) clonogenics assay on day 7 showing β-S33Y overexpression partially rescues the effect of Indomethacin on cell survival in OV81.2. ( e ) 48 h Annexin-V PI staining flow cytometry analysis showing that β-S33Y overexpressing OV81.2 cells are more tolerant to Indomethacin induced cell death. ( f ) Western blot confirming lentiviral shRNA mediated β-catenin knockdown. ( g ) 48 h analysis of Annexin-V PI staining showing increased cell death upon Indomethacin treatment in OV81.2-CP10 and CP70 sh-β-catenin cells compared with sh-scram control (* P <0.05, ** P <0.005 and. *** P <0.0005).

Article Snippet: Several stable cell lines were generated for this study and the same protocol was followed as described below. β-catenin lentiviral shRNA plasmid (Addgene plasmid 18803 deposited by Dr Bob Weinberg’s laboratory) and the corresponding pLKO.1 control plasmid (Addgene plasmid 8453 deposited by Dr Bob Weinberg’s laboratory) were acquired from Addgene.

Techniques: Western Blot, Real-time Polymerase Chain Reaction, Expressing, Over Expression, Staining, Flow Cytometry, shRNA, Knockdown, Control

Journal:

Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression

doi: 10.1002/pros.21213

Figure Lengend Snippet: A: Western blot analysis of Slug expression in PC-3 cell lines harboring control shRNA or Slug shRNAs. PC-3 cells were infected with lentiviruses expressing control shRNA, Slug shRNA1, or Slug shRNA2, and selected with puromycin (1 µg/ ml). Proteins were extracted from the stable lines and analyzed by Western blot with anti-Slug antibody and anti-β-actin antibody.

Article Snippet: Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA).

Techniques: Western Blot, Expressing, Control, shRNA, Infection